ifnb promoter  (Addgene inc)

Journal: bioRxiv

Article Title: Mitochondrial Respiratory Chain Function is crucial for Muscle Toxicity in Facioscapulohumeral Muscular Dystrophy

doi: 10.1101/2025.11.25.690559

Figure Lengend Snippet: (A) Left: longitudinal quantitation of DUX4 and ZSCAN4-tdTomato containing nuclei in iDUX4 ZSCAN4-tdT reporter myoblasts at 2h intervals after DOX (62.5 ng/mL). Right: immunofluorescence micrographs of iDUX4 ZSCAN4-tdT reporter myoblasts before (0h), and 4h and 16h after exposure to DOX (62.5 ng/mL; green=DUX4, red=ZSCAN4-tdTomato, blue=nuclei; scale bar=100μm). (B) Normalised oxygen consumption rate (OCR) curves of iDUX4 control (CTRL) and DOX-induced (62.5 ng/mL DOX for 4h and 16h) myoblasts. (C) Respirometric assessment of mitochondrial respiration reveals reduction of basal, maximal and ATP-linked respiration in iDUX4 myoblasts 4h after DOX (62.5 ng/mL). (D) Normalised extracellular acidification rate (ECAR) curves of iDUX4 control (CTRL) and DOX-induced (62.5 ng/mL DOX for 4h and 16h) myoblasts. (E) ATP production rates demonstrating reduction of ATP in iDUX4 myoblasts 4h after DOX (62.5 ng/mL), mainly arising from defective oxidative phosphorylation (OXPHOS; mitoATP), while glycoATP is unaffected before 16h. (F) Assaying of Casp9 (red; onset 4h after DOX) and Casp3/7 activation (grey; onset 8h after DOX), measured at 2h intervals over 16h. (G) Assaying Annexin V as a marker of apoptosis in iDUX4 myoblasts after DOX (62.5 ng/mL), measured at 2h intervals over 16h. (H) Casp3/7 activation in iDUX4 myoblasts 8h after DOX (62.5 ng/mL) is prevented by a Casp9 inhibitor (Z-LEHD-FMK TFA; 10 μM). (I) Casp3/7 and Casp9 activation in iDUX4 myoblasts 8h after DOX (62.5 ng/mL) with non-targeted (Q10; 20 μM) or mitochondria-targeted (mitoQ10; 20μM) Coenzyme Q10. [n=3-6, data is mean ± s.d., where * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001].

Article Snippet: The inducible iDUX4 ZSCAN4-tdT reporter line was generated by transduction of iDUX4 myoblasts with a Lentiviral vector encoding tdTomato with nuclear localisation signals on both ends under control of the minimal promoter of ZSCAN4 (Fig. S6). pGL3 Zscan4 promoter plasmid was a gift from Stephen Tapscott (Addgene plasmid #69249; http://n2t.net/addgene:69249 ; RRID: Addgene_69249) [ ].

Techniques: Quantitation Assay, Immunofluorescence, Control, Phospho-proteomics, Activation Assay, Marker

Journal: bioRxiv

Article Title: Mitochondrial Respiratory Chain Function is crucial for Muscle Toxicity in Facioscapulohumeral Muscular Dystrophy

doi: 10.1101/2025.11.25.690559

Figure Lengend Snippet: (A) Workflow for generation of ρ 0 -like iDUX4 myoblasts: cells were treated with ethidium bromide (50, 100 or 150 nM EtBr) for two weeks, yielding ρ 0 -like iDUX4 cells with varying degrees of OXPHOS impairment (iDUX4-ρ 0+ : mild OXPHOS reduction, iDUX4-ρ 0++ : severe OXPHOS reduction and iDUX4-ρ 0+++ : full OXPHOS inhibition). Scheme was created with BioRender.com . (B) Percentage of OXPHOS versus glycolytic ATP production rate in iDUX4-ρ 0 myoblasts, with mitoATP and glycoATP production rates indicated, as determined by Seahorse respirometry. (C) Immunofluorescence (green=DUX4, blue=nuclei; scale bar=100μm) with percentage of DUX4-positive nuclei of unmodified iDUX4 and iDUX4- ρ 0+++ myoblasts after DOX (62.5 ng/mL) for 16h. (D) Expression levels of DUX4 target genes ZSCAN4 , PRAMEF1 and TRIM43 , as assessed by RT-qPCR (relative to housekeeper RPLP0 ). (E) DUX4-induced increases in mitoROS and ΔΨm in unmodified iDUX4 cells are not observed in iDUX4- ρ 0+++ myoblasts after DOX (62.5 ng/mL) for 16h. (F) DUX4-induced Casp9 activation in unmodified iDUX4 myoblasts does not occur in iDUX4- ρ 0+++ cells after DOX (62.5 ng/mL) for 8h. (G) Annexin V and Casp3/7 activation in iDUX4, iDUX4-ρ 0+ , iDUX4-ρ 0++ and iDUX4-ρ 0+++ myoblasts after DOX (62.5 ng/mL) for 36h shows inverse correlation between DUX4-induced apoptosis and mitochondrial respiratory chain impairment. DUX4 is unable to induce apoptosis in fully OXPHOS-deficient iDUX4-ρ 0+++ myoblasts. (H) Both non-DUX4-induced iDUX4 and iDUX4-ρ 0+++ myoblasts undergo apoptosis (Annexin V) after exposure to the apoptosis inducer staurosporine (STSP; 1 μM) for 48h. [n=3-12, data is mean ± s.d., where * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001].

Article Snippet: The inducible iDUX4 ZSCAN4-tdT reporter line was generated by transduction of iDUX4 myoblasts with a Lentiviral vector encoding tdTomato with nuclear localisation signals on both ends under control of the minimal promoter of ZSCAN4 (Fig. S6). pGL3 Zscan4 promoter plasmid was a gift from Stephen Tapscott (Addgene plasmid #69249; http://n2t.net/addgene:69249 ; RRID: Addgene_69249) [ ].

Techniques: Inhibition, Immunofluorescence, Expressing, Quantitative RT-PCR, Activation Assay

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 upregulates expression of PD-L1 and CCL2. (A) mRNA-seq analysis of ZEB2-overexpressing SW480 cells and analysis of KEGG pathways affected by ZEB2 expression. The size of each circle represents the number of genes involved in the corresponding pathway and the color scale denotes the P-value (upper). Changes in expression of cytokine-related genes in ZEB2-overexpressing SW480 cells are vs. those in control cells (lower). (B) RT-qPCR of CCL2 , CCL28 , CXCL2 , CXCL3 , CXCL6 and CXCL12 levels in ZEB2-overexpressing vs. control SW480 cells (upper) and in ZEB2-suppressed vs. control SNU-398 cells (lower; n=4). (C) RT-qPCR of CD274 mRNA levels in ZEB2-overexpressing vs. control SW480 cells (left) and in ZEB2-suppressed vs. control SNU-398 cells (right; n=4). (D) Analysis of CCL2 and PD-L1 protein levels in ZEB2-overexpressing vs. control SW480 cells (left), in ZEB2-suppressed vs. control SNU-398 cells (middle) and in ZEB2-overexpressing vs. control PC3 cells (right). Densitometric quantification of bands on the immunoblot was performed, with β-actin or GAPDH as a loading control. (E) Reporter analysis of CD274 and CCL2 promoter activity in ZEB2-overexpressing vs. control SW480 cells (upper) and in ZEB2-suppressed vs. control SNU-398 cells (lower; n=4). (F) Flow cytometry analysis of PD-L1 expression in SW480 cells transfected with ZEB2, TWIST1, or SNAIL expression vectors (n=3). Cells treated with IFN-γ or transfected with a PD-L1 expression vector were used as positive controls. Immunoblot analysis confirmed overexpression of ZEB2 (anti-myc), TWIST1 (anti-flag) and SNAIL (anti-SNAIL). (G) ELISA to measure secreted levels of CCL2 in conditioned medium from ZEB2-suppressed vs. control SNU-398 cells (n=3). (H, I) Scatter plots of ZEB2 mRNA expression vs. CD274 (H) and CCL2 (I) mRNA expression in colorectal adenocarcinoma (data from TCGA, Firehose Legacy and TCGA, Nature 2012). Correlations were statistically analyzed using the Spearman test. Spearman's correlation coefficients and equations were automatically generated using the cBioPortal webpage tool. (J) Kaplan-Meier analysis showing the relationship between overall survival of colon cancer (CPTAC-2, Prospective, Cell 2019; n=106) and pancreatic adenocarcinoma (TCGA, Firehose Legacy; n=178) patients and expression of ZEB2 and CD274 mRNA. P-values were calculated by the log-rank test. Values represent the mean ± standard deviation. * P<0.05; ** P<0.01; *** P<0.001; N.S, not significant. ZEB2, Zinc Finger E-Box Binding Homeobox 2; PD-L1, programmed cell death 1 ligand 1; CCL2, C-C motif chemokine ligand 2; KEGG, Kyoto Encyclopedia of Genes and Genomes; RT-qPCR, reverse transcription-quantitative PCR; ELISA, enzyme-linked immunosorbent assay; TCGA, The Cancer Genome Atlas; sh, short hairpin.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Expressing, Control, Quantitative RT-PCR, Western Blot, Activity Assay, Flow Cytometry, Transfection, Plasmid Preparation, Over Expression, Enzyme-linked Immunosorbent Assay, Generated, Standard Deviation, Binding Assay, Reverse Transcription, Real-time Polymerase Chain Reaction

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 cooperates with SP1 to promote transcription of CD274 and CCL2 by binding directly to their promoters. (A) SW480 cells were co-transfected with siRNA specific for SP1 (siSP1) and with a ZEB2 expression vector, for 48 h prior to immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. (B) RT-qPCR of CD274 (upper) and CCL2 (lower) levels in SW480 cells co-transfected with siSP1 and the ZEB2 expression vector (n=4). (C) Mutation analysis of the SP1 site in the CD274 and CCL2 promoters. SW480 cells were transfected with reporter constructs containing SP1 site mutations and reporter activity was measured (n=4). Values represent mean ± SD. *** P<0.001, vs. vector + control siRNA; $$$ P<0.001, vs. ZEB2 + control siRNA. (D) ChIP analysis of the interaction between ZEB2 and SP1 and the CD274 and CCL2 promoters. Chromatin fragments from SNU-398 cells were immunoprecipitated by normal mouse IgG (lane 1), anti-ZEB2 (lane 2), or anti-SP1 (lane 3) and data were analyzed by semiquantitative PCR using CD274 (-181/-41) and CCL2 (-115/+25) promoter primers. The input control (1%) is shown in lane 4. Irrelevant regions (-807/-660 for CD274 and -1820/-1675 for CCL2 ) were also analyzed. ZEB2, Zinc Finger E-Box Binding Homeobox 2; si, small interfering; RT-qPCR, reverse transcription-quantitative PCR; PD-L1, programmed cell death 1 ligand 1; CCL2, C-C motif chemokine ligand 2; ChIP, chromatin immunoprecipitation.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Binding Assay, Transfection, Expressing, Plasmid Preparation, Western Blot, Control, Quantitative RT-PCR, Mutagenesis, Construct, Activity Assay, Immunoprecipitation, Reverse Transcription, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 suppresses T cell activation by upregulating PD-L1. (A) Jurkat cells transfected with NFAT-reporter construct were co-cultured for 24 h with stable SNU-398 cells (control vs. ZEB2-suppressed cells) and luciferase activity was measured 24 h after stimulation with PMA and ionomycin (n=4). (B) IL-2 secreted by Jurkat cells co-cultured with stable SNU-398 cells was measured in an ELISA (n=3). (C) Jurkat cells were co-cultured for 24 h with stable SNU-398 cells and then stimulated for 24 h with PMA and ionomycin prior to immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. Phosphorylated proteins were normalized against the corresponding total protein values. (D) Effect of an anti-PD-1 antibody on NFAT activity in Jurkat cells co-cultured with stable SNU-398 cells (n=4). Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001. $$$ P<0.001 vs. Jurkat + PMA + ionomycin. ZEB2, Zinc Finger E-Box Binding Homeobox 2; PD-L1, programmed cell death 1 ligand 1; NFAT, Nuclear factor of activated T cells; ELISA, enzyme-linked immunosorbent assay; PMA, phorbol 12-myristate 13-acetate; p-, phosphorylated; sh, short hairpin.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Activation Assay, Transfection, Construct, Cell Culture, Control, Luciferase, Activity Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Binding Assay

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 SUMOylation through PC2 is required for ZEB2 acting as a transcriptional activator and playing subsequent cellular functions. (A) SW480 cells were transfected with ZEB2WT and ZEB2_K391/866R for 48 h prior to lysis and immunoblot analysis. (B) Reporter assay of ITGA5 (integrin α5), VIM (vimentin), VEGFA , CDH1 , CD274 and CCL2 promoter activity in SW480 cells transfected with ZEB2WT and ZEB2_K391/866R (n=4). (C) Invasion (representative fields at magnification, ×100), (D) survival and (E) anchorage-independent growth of SW480 cells transfected with ZEB2WT and ZEB2_K391/866R (n=3). (F) SW480 cells were co-transfected with shRNA specific for CBX4 (shPC2) and with a ZEB2-expression vector, for 48 h prior to lysis and immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001; N.S, not significant. ZEB2, Zinc Finger E-Box Binding Homeobox 2; SUMO, small ubiquitin-like modifier; CCL2, C-C motif chemokine ligand 2; PD-L1, programmed cell death 1 ligand 1; VEGF, vascular endothelial growth factor; sh, short hairpin; WT, wild type; Mut, mutant.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Transfection, Lysis, Western Blot, Reporter Assay, Activity Assay, shRNA, Expressing, Plasmid Preparation, Control, Binding Assay, Ubiquitin Proteomics, Mutagenesis

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: SUMOylation of ZEB2 is required for cooperation between ZEB2 and SP1. Reporter assay to determine transcriptional activity of SP1 in SW480 cells (n=4). (A) Cells were transfected with ZEB2WT and ZEB2_K391/866R expression vectors for 48 h. (B) Cells were co-transfected with a ZEB2 expression vector and siRNA specific for CBX4 (siPC2) for 48 h. Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001. (C) SW480 cells transfected with ZEB2WT and ZEB2_K391/866R expression vectors were treated with cycloheximide for the indicated times prior to lysis and immunoblot analysis. (D) A cytosolic fraction and a nuclear fraction were prepared from 293E cells transfected for 48 h with ZEB2WT and ZEB2_K391/866R expression vectors. GAPDH and PARP were used as internal controls for the cytosolic and nuclear fractions, respectively. (E) Co-immunoprecipitation analysis of the interaction between ZEB2 and SP1 in 293E cells co-transfected with ZEB2 (WT vs. K391/866R) and SP1 expression vectors. (F) Kaplan-Meier analysis showing the probability of progression-free survival of patients with colorectal adenocarcinoma (TCGA, PanCancer Atlas; n=588) in relation to CBX4 mRNA expression. (G) Overall survival of patients with colorectal adenocarcinoma (TCGA, PanCancer Atlas; n=568) in relation to expression of ZEB2 and CBX4 mRNA. P-values were calculated using the log-rank test. SUMO, small ubiquitin-like modifier; ZEB2, Zinc Finger E-Box Binding Homeobox 2; CCL2, C-C motif chemokine ligand 2; PD-L1, programmed cell death 1 ligand 1; VEGF, vascular endothelial growth factor; TCGA, The Cancer Genome Atlas; si, small interfering; WT, wild type; Mut, mutant.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Reporter Assay, Activity Assay, Transfection, Expressing, Plasmid Preparation, Lysis, Western Blot, Immunoprecipitation, Ubiquitin Proteomics, Binding Assay, Mutagenesis